README
bedJS
Manage BED (Browser Extensible Data) files with Node.JS (Bioinformatics).
Install
Use NPM to install the package:
npm install bedjs
Overview
About the BED file format
A BED file is a tab delimited containing one feature of interest per line. Each line must contain at least the three first fields listed below:
| KEY | Description | Type |
|---|---|---|
| chromosome | Chromosome name | String |
| start | Start position of the feature | Integer |
| end | End position of the feature | Integer |
| name | Name of the line | String |
| score | Score between 0 and 1000 | Integer |
| strand | Strand of the feature ('+' or '-') | String |
| thickStart | Start position at which the feature is drawn thickly | Integer |
| thickEnd | End position at which the feature is drawn thickly | Integer |
| itemRgb | RGB value in format R,G,B | String |
| blockCount | The number of blocks (exons) in the BED line | Integer |
| blockSizes | A comma-separated list of the block sizes | String |
| blockStarts | A comma-separated list of block starts | String |
You can read more about the BED format here.
The BED object
This tool will convert each line of a BED file in one JavaScript object, where each column of the BED file will be saved with the format key=value. The key attribute will be one of the previous table.
Example of a BED file:
1 6579260 6579725 PLEKHG5
1 10292069 10292214 KIF1B
1 33282660 33282997 YARS
1 156084621 156085204 LMNA
The previous BED file converted to a BED object will be:
[
{ chromosome: '1', start: 6579260, end: 6579725, name: 'PLEKHG5' },
{ chromosome: '1', start: 10292069, end: 10292214, name: 'KIF1B' },
{ chromosome: '1', start: 33282660, end: 33282997, name: 'YARS' },
{ chromosome: '1', start: 156084621, end: 156085204, name: 'LMNA' }
]
API
Include the package in your JavaScript code using:
var bedJS = require('bedjs');
bedJS.Read(file)
Read a BED file. Returns an array with one BED object for each line of the BED file.
var bed = bedJS.Read('example.bed');
bedJS.Write(file, bed)
Save an array with BED objects to a BED file.
bedJS.Write('newfile.bed', bed);
bedJS.Collapse
A class to combine all BED objects into a new object. The following combining methods are available:
bedJS.Collapse.ByRegion(bed)
Combines all BED objects with overlapping features into a new BED object. This method only combines all features that have the same chromosome and the same strand.
Example of a BED object:
[
{ "chromosome": "2", "start": 500, "end": 600, "name": "REGION1", "score": 0, "strand": "+" },
{ "chromosome": "2", "start": 550, "end": 700, "name": "REGION2", "score": 0, "strand": "+" },
{ "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" }
]
If now we run:
var bed2 = bedJS.Collapse.ByRegion(bed);
This will return the following array:
[
{ "chromosome": "2", "start": 500, "end": 700, "name": "REGION1,REGION2", "score": 0, "strand": "+" },
{ "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" }
]
bedJS.Collapse.ByName(bed)
Combines all BED objects that have the same feature name. The output object will have the minimum start position and the maximum end position of all objects combined.
Example of a BED object:
[
{ "chromosome": "2", "start": 500, "end": 600, "name": "REGION1", "score": 0, "strand": "+" },
{ "chromosome": "2", "start": 700, "end": 800, "name": "REGION1", "score": 0, "strand": "+" },
{ "chromosome": "2", "start": 500, "end": 700, "name": "REGION2", "score": 0, "strand": "-" }
]
If now we run:
var bed2 = bedJS.Collapse.ByName(bed);
This will return the following array:
[
{ "chromosome": "2", "start": 500, "end": 800, "name": "REGION1", "score": 0, "strand": "+" },
{ "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" }
]
bedJS.Fasta
A set of tools to work with Fasta files.
bedJS.Fasta.Index(file)
Create an index of your Fasta file in JSON format. This index is required if you want to use the bedJS.Fasta.Get function.
bedJS.Fasta.Index('fasta_file.fa');
The previous command will generate a file called fasta_file.fa.json. Once you have created the index file, you don't need to run it again.
bedJS.Fasta.Get(fasta, bed, opt)
A method to extract sequences from a Fasta file using the regions delimited in your BED file or in your BED object. The inputs of this method are:
fasta: the path of your fasta file where you will extract the sequence.bed: a BED object or the path to a BED file with the regions where you want to extract the sequence.opt: an object with the following keys:strand: set it totrueif you want to extract the sequence with the same orientation defined in the BED file. Default isfalse.
This will return an array with the sequence for each BED object.
Note that you must run bedJS.Fasta.Index to index the Fasta file before run this function.
Example of a Fasta file:
test.fa:
>1
ACTGAAAAACCCGGTTTAACGTACCGG
Example of a bed file
test.bed:
1 5 10
If you run:
var sequence = bedJS.Fasta.Get('test.fa', 'test.bed', { strand: false });
// -> sequence = [ { "head": "1:5-10", "sequence": "AAAAC"}]
License
© MIT LICENSE Jose M. Juanes.